View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15895_low_65 (Length: 215)

Name: NF15895_low_65
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15895_low_65
NF15895_low_65
[»] chr6 (3 HSPs)
chr6 (13-190)||(4845105-4845284)
chr6 (37-95)||(4818834-4818893)
chr6 (138-197)||(4814663-4814722)


Alignment Details
Target: chr6 (Bit Score: 153; Significance: 3e-81; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 153; E-Value: 3e-81
Query Start/End: Original strand, 13 - 190
Target Start/End: Complemental strand, 4845284 - 4845105
Alignment:
Q  13 gattatactcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatgttttt--gcaaattgagttttgacacc 110  Q
    ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||  ||||||||||||||||||||    
T  4845284 gattatattcgattcacaaactataaggatcaaatacaaagggatttgtggatgaatcaattagccaagtatttttttttgcaaattgagttttgacacc 4845185  T
Q  111 tcactgttctattcgaaatataaaaggttccggccatcggacatttaagttgcggttgagatgatgcacttttcttgggg 190  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||    
T  4845184 tcactgttctatttgaaatataaaaggttccggccatcggacatttaagttgcggttgatatgatgcacttttcttgggg 4845105  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 37 - 95
Target Start/End: Complemental strand, 4818893 - 4818834
Alignment:
Q  37 aaggatcaaatacaaagggatttgtggatgaatcaa-ttagccaagtatgtttttgcaaa 95  Q
    ||||||||||||||||||||||||||||||||| || |||||||||||| |||| |||||    
T  4818893 aaggatcaaatacaaagggatttgtggatgaataaatttagccaagtattttttcgcaaa 4818834  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 138 - 197
Target Start/End: Complemental strand, 4814722 - 4814663
Alignment:
Q  138 ttccggccatcggacatttaagttgcggttgagatgatgcacttttcttggggcaggtaa 197  Q
    |||| |||||| ||||||| |||  ||||||||||||||| |||||||||||||||||||    
T  4814722 ttccagccatctgacatttcagtgacggttgagatgatgcccttttcttggggcaggtaa 4814663  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University