View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15895_low_62 (Length: 235)

Name: NF15895_low_62
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15895_low_62
NF15895_low_62
[»] chr3 (2 HSPs)
chr3 (87-220)||(41139286-41139418)
chr3 (27-69)||(41139224-41139266)


Alignment Details
Target: chr3 (Bit Score: 118; Significance: 2e-60; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 118; E-Value: 2e-60
Query Start/End: Original strand, 87 - 220
Target Start/End: Original strand, 41139286 - 41139418
Alignment:
Q  87 ttgaagtaatgattcagcatctattgtagccattgatacccatttctttgatttttaaggatgaaatgtacatgagtcttccttttttcaaagccaagaa 186  Q
    ||||||||||||||||||||||||||||| |||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||    
T  41139286 ttgaagtaatgattcagcatctattgtagtcattgatacccatttccttgatttttaaggatgaaatgtacatgagtcttcc-tttttcaaagccaagaa 41139384  T
Q  187 ttttgagatcatgtaccataaccataacagttct 220  Q
    ||||||||||||||||||||||||||||||||||    
T  41139385 ttttgagatcatgtaccataaccataacagttct 41139418  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 27 - 69
Target Start/End: Original strand, 41139224 - 41139266
Alignment:
Q  27 taatagggtccttgttacctatcctatttagacgaaaacacac 69  Q
    |||||||||||||||||||||||||||||||||||||||||||    
T  41139224 taatagggtccttgttacctatcctatttagacgaaaacacac 41139266  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University