View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15895_low_53 (Length: 254)

Name: NF15895_low_53
Description: NF15895
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15895_low_53
NF15895_low_53
[»] chr5 (2 HSPs)
chr5 (97-241)||(25830007-25830151)
chr5 (41-87)||(25829930-25829976)


Alignment Details
Target: chr5 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 97 - 241
Target Start/End: Original strand, 25830007 - 25830151
Alignment:
Q  97 tatatagttccttctttctcaaccgtctttcctaaggttccctcaatgtggagtctccactcgtcttcgttgaatcgttctctccccatttttctcccct 196  Q
    ||||||||||||||||||||||||||||||| || ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  25830007 tatatagttccttctttctcaaccgtctttcatagggttccctcaatgtggagtctccactcctcttcgttgaatcgttctctccccatttttctcccct 25830106  T
Q  197 ctatcgggtacgtagttggactcgccaatgacaaattattcccct 241  Q
    ||||||||||||||| ||||||||||||||||| |||||||||||    
T  25830107 ctatcgggtacgtagctggactcgccaatgacagattattcccct 25830151  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 41 - 87
Target Start/End: Original strand, 25829930 - 25829976
Alignment:
Q  41 gatatggttttaaggaaggcaatgtgtttttctgtttatgtgattaa 87  Q
    ||||| ||||||||||||||||||||||||||||||| |||||||||    
T  25829930 gatattgttttaaggaaggcaatgtgtttttctgtttttgtgattaa 25829976  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University