View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15894_high_15 (Length: 305)

Name: NF15894_high_15
Description: NF15894
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15894_high_15
NF15894_high_15
[»] chr4 (2 HSPs)
chr4 (66-288)||(48116245-48116465)
chr4 (9-55)||(48116555-48116601)


Alignment Details
Target: chr4 (Bit Score: 156; Significance: 7e-83; HSPs: 2)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 156; E-Value: 7e-83
Query Start/End: Original strand, 66 - 288
Target Start/End: Complemental strand, 48116465 - 48116245
Alignment:
Q  66 ataattgacagataaaggagcgtatatatttaatggatgaaataaagttatannnnnnnnagttcgcaccccaaccatct-agagtggctccagaacaag 164  Q
    ||||| |||| ||||||||||  |||||||||||||||||||||||||||||        ||||||||||||| |||||| ||||||||||||||||||     
T  48116465 ataatggacaaataaaggagc--atatatttaatggatgaaataaagttatattttttt-agttcgcaccccagccatcttagagtggctccagaacaaa 48116369  T
Q  165 taattgtctcatacatatgatttacaattcaaattgaataagttgtcaaaatacaaggatatttctctacaaaatctgctgagattttccctcaaattat 264  Q
    ||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  48116368 taattgtctcatacacatgatttacaattcaaattgaataagttgtcaaaatacaaggatatttctctacaaaatctgctgagattttccctcaaattat 48116269  T
Q  265 gcaaagttggtagatgatgccagt 288  Q
    ||||||||||||||||||||||||    
T  48116268 gcaaagttggtagatgatgccagt 48116245  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 47; E-Value: 8e-18
Query Start/End: Original strand, 9 - 55
Target Start/End: Complemental strand, 48116601 - 48116555
Alignment:
Q  9 gaagaatatcatactgaattaatatgtatggcatacacaacttgaac 55  Q
    |||||||||||||||||||||||||||||||||||||||||||||||    
T  48116601 gaagaatatcatactgaattaatatgtatggcatacacaacttgaac 48116555  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University