View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15891_high_10 (Length: 204)

Name: NF15891_high_10
Description: NF15891
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15891_high_10
NF15891_high_10
[»] chr5 (1 HSPs)
chr5 (17-188)||(15714184-15714355)


Alignment Details
Target: chr5 (Bit Score: 156; Significance: 4e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 156; E-Value: 4e-83
Query Start/End: Original strand, 17 - 188
Target Start/End: Original strand, 15714184 - 15714355
Alignment:
Q  17 gagaacaaatcgttagcatatgcttttcacccagagaataatgtcacagacaatgtcaagtctttgtttcaagacgcgtttaaccgttggtcaaatgcaa 116  Q
    ||||||| ||||||||||||||||||||| |||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||    
T  15714184 gagaacagatcgttagcatatgcttttcatccagagaataatgtcacagacaatgttaagtctttgtttcaagacgcgtttaaccgttggtcaaatgcaa 15714283  T
Q  117 ctgaattgaacttcattgagacaacgtcgtttaatgattcagatattcgtatagcgtttttaacgttggatg 188  Q
    |||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||    
T  15714284 ctgaattgaacttcattgagacaatgtcgtttaatgattcagatattcgtatagcgtttttaacgttggatg 15714355  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University