View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15882_high_11 (Length: 245)

Name: NF15882_high_11
Description: NF15882
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15882_high_11
NF15882_high_11
[»] chr6 (1 HSPs)
chr6 (144-218)||(22422587-22422661)
[»] chr3 (1 HSPs)
chr3 (65-121)||(27174388-27174443)


Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 144 - 218
Target Start/End: Original strand, 22422587 - 22422661
Alignment:
Q  144 tgatcaagttgtattcatatagttaatttgatataagaattattgtaatatcttctttatgagagttatatatat 218  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22422587 tgatcaagttgtattcatatagttaatttgatataagaattattgtaatatcttctttatgagagttatatatat 22422661  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 65 - 121
Target Start/End: Original strand, 27174388 - 27174443
Alignment:
Q  65 attaatagagatagaaaaaacctcattggagtaactttcaaccttggtccttcaatc 121  Q
    ||||| ||||||||||||||| |||||| ||||||||||||||| ||||||||||||    
T  27174388 attaacagagatagaaaaaac-tcattgcagtaactttcaacctcggtccttcaatc 27174443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University