View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1586_low_25 (Length: 227)

Name: NF1586_low_25
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1586_low_25
NF1586_low_25
[»] chr5 (1 HSPs)
chr5 (7-162)||(15632127-15632282)


Alignment Details
Target: chr5 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 7 - 162
Target Start/End: Complemental strand, 15632282 - 15632127
Alignment:
Q  7 ggccaaagaattgataactcctagtggccctgttcaggtaacaacaaactgcttgtcgaggatgtctcaacggttatcttcccaaaatatctaatttact 106  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15632282 ggccaaagaattgataactcctagtggccctgttcaggtaacaacaaactgcttgtcgaggatgtctcaacggttatcttcccaaaatatctaatttact 15632183  T
Q  107 cttaactatccagttgcactatgcttgaagatcttgttgtttgattttcaaaaaca 162  Q
    || |||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  15632182 ctgaactatccagttgcactatgcttgaagatcttgttgtttgattttcaaaaaca 15632127  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University