View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1586_high_23 (Length: 212)

Name: NF1586_high_23
Description: NF1586
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1586_high_23
NF1586_high_23
[»] chr3 (1 HSPs)
chr3 (10-190)||(48541563-48541744)


Alignment Details
Target: chr3 (Bit Score: 166; Significance: 5e-89; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 166; E-Value: 5e-89
Query Start/End: Original strand, 10 - 190
Target Start/End: Complemental strand, 48541744 - 48541563
Alignment:
Q  10 agattatactcagataataggaaggaaaagatggagcttctaaatggattgtccataggaaaggttgatacttcaaacatttcacctcttcaacaggt-a 108  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |    
T  48541744 agattatactcagataataggaaggaaaagatggagcttctaaatggattgtccataggaaaggttgatacttcaaacatttcacctcttcaacaggtaa 48541645  T
Q  109 actaaatgtgcaaccgtacgagtaaattaaatgtgtacttcaacagcagattaatttacattactcgtacatatccaggaag 190  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||    
T  48541644 actaaatgtgcaaccgtacgagtaaattaaatgtgtacttcaacagctgattaatttacattactcatacatatccaggaag 48541563  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University