View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15864_low_32 (Length: 354)

Name: NF15864_low_32
Description: NF15864
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15864_low_32
NF15864_low_32
[»] chr3 (1 HSPs)
chr3 (254-297)||(2411287-2411330)
[»] scaffold0393 (1 HSPs)
scaffold0393 (256-296)||(13671-13710)


Alignment Details
Target: chr3 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 254 - 297
Target Start/End: Original strand, 2411287 - 2411330
Alignment:
Q  254 taagttttttgggtgctatgatacaccacgtagtgtaaaacata 297  Q
    |||||||||||||||||||||||||||| |||||||||||||||    
T  2411287 taagttttttgggtgctatgatacaccatgtagtgtaaaacata 2411330  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0393 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: scaffold0393
Description:

Target: scaffold0393; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 256 - 296
Target Start/End: Original strand, 13671 - 13710
Alignment:
Q  256 agttttttgggtgctatgatacaccacgtagtgtaaaacat 296  Q
    ||||||||||||| |||||||||||| ||||||||||||||    
T  13671 agttttttgggtg-tatgatacaccatgtagtgtaaaacat 13710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University