View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15856_low_3 (Length: 540)

Name: NF15856_low_3
Description: NF15856
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15856_low_3
NF15856_low_3
[»] chr6 (3 HSPs)
chr6 (81-175)||(31093208-31093302)
chr6 (355-489)||(31073966-31074093)
chr6 (84-176)||(31033934-31034026)
[»] scaffold0202 (1 HSPs)
scaffold0202 (37-176)||(1899-2020)
[»] scaffold0016 (1 HSPs)
scaffold0016 (87-176)||(30980-31069)


Alignment Details
Target: chr6 (Bit Score: 79; Significance: 1e-36; HSPs: 3)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 79; E-Value: 1e-36
Query Start/End: Original strand, 81 - 175
Target Start/End: Original strand, 31093208 - 31093302
Alignment:
Q  81 ttaaaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttagga 175  Q
    ||||||||||||||||||||||||||||||||||||||| ||| |  ||||||||||||||||||||||||||||||||||||||||||||||||    
T  31093208 ttaaaatgctttcccggaactggatgagatcaaaatcattgggatatggatatgcaatatcacattagtggactaaccctctagcttgtttagga 31093302  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #2
Raw Score: 69; E-Value: 1e-30
Query Start/End: Original strand, 355 - 489
Target Start/End: Complemental strand, 31074093 - 31073966
Alignment:
Q  355 ttttgtgcctagtgaaaaaatgtatgatggagtcccataacaccacttagttcatacagttttgtcatgtaatgtactatgacctaaataatttaaccac 454  Q
    |||||||  |||||||  ||||||||||||||||||||||||||||||||||||| || ||||||| | |||||||||||| || |||||||||||||||    
T  31074093 ttttgtgggtagtgaagtaatgtatgatggagtcccataacaccacttagttcattcaattttgtcttataatgtactatggccaaaataatttaaccac 31073994  T
Q  455 cctcttcccccttcatcatactttaaattattcca 489  Q
    |||       |||||||||||||||||||||||||    
T  31073993 cct-------cttcatcatactttaaattattcca 31073966  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6; HSP #3
Raw Score: 29; E-Value: 0.0000008
Query Start/End: Original strand, 84 - 176
Target Start/End: Complemental strand, 31034026 - 31033934
Alignment:
Q  84 aaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 176  Q
    ||||||||||| | |||||||| || ||| ||||||| ||||  |||||| |||||||  | | ||||||||||||| || ||| ||||||||    
T  31034026 aaatgctttcctgaaactggataaggtcataatcatcagggtttggatattcaatatcgaagtcgtggactaaccctttaccttttttaggag 31033934  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0202 (Bit Score: 52; Significance: 1e-20; HSPs: 1)
Name: scaffold0202
Description:

Target: scaffold0202; HSP #1
Raw Score: 52; E-Value: 1e-20
Query Start/End: Original strand, 37 - 176
Target Start/End: Original strand, 1899 - 2020
Alignment:
Q  37 tcacgatataagtgtttcgactgatactattttagaactgcattttaaaatgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgca 136  Q
    |||||||||||||||||||||||||||||||| ||||| |    |||||||||||||| ||||| ||||||||||                |||||||||    
T  1899 tcacgatataagtgtttcgactgatactatttcagaacagg---ttaaaatgctttcctggaaccggatgagatct---------------ggatatgca 1980  T
Q  137 atatcacattagtggactaaccctctagcttgtttaggag 176  Q
    ||||||||||||||||||||||||||||||||||||||||    
T  1981 atatcacattagtggactaaccctctagcttgtttaggag 2020  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: scaffold0016 (Bit Score: 42; Significance: 0.00000000000001; HSPs: 1)
Name: scaffold0016
Description:

Target: scaffold0016; HSP #1
Raw Score: 42; E-Value: 0.00000000000001
Query Start/End: Original strand, 87 - 176
Target Start/End: Original strand, 30980 - 31069
Alignment:
Q  87 tgctttcccggaactggatgagatcaaaatcatcggggtcaggatatgcaatatcacattagtggactaaccctctagcttgtttaggag 176  Q
    |||||||| | |||||||| || |||||||||||| |||  ||||||||||||||| | | |||||||||||||||| ||| ||||||||    
T  30980 tgctttcctgaaactggataaggtcaaaatcatcgaggtttggatatgcaatatcaaagttgtggactaaccctctaccttttttaggag 31069  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University