View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15854_low_7 (Length: 227)

Name: NF15854_low_7
Description: NF15854
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15854_low_7
NF15854_low_7
[»] chr5 (2 HSPs)
chr5 (2-102)||(9560403-9560503)
chr5 (158-227)||(9560558-9560627)


Alignment Details
Target: chr5 (Bit Score: 101; Significance: 3e-50; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 101; E-Value: 3e-50
Query Start/End: Original strand, 2 - 102
Target Start/End: Original strand, 9560403 - 9560503
Alignment:
Q  2 catcacccatcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgg 101  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9560403 catcacccatcattgacgaacattccaaacacgcccttaactttagcttaaaactaaaatgaatattattatatcattctaaacgcgaattcgaatttgg 9560502  T
Q  102 a 102  Q
    |    
T  9560503 a 9560503  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 158 - 227
Target Start/End: Original strand, 9560558 - 9560627
Alignment:
Q  158 ctgagaaagtgtgagaaagtttctgtaactagcttcaacggttttagcgggaaattagttttctcttcct 227  Q
    |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    
T  9560558 ctgagaaagtgtgagaaaatttctgtaactagcttcaacggttttagcgggaaattagttttctcttcct 9560627  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University