View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15853_low_11 (Length: 216)

Name: NF15853_low_11
Description: NF15853
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15853_low_11
NF15853_low_11
[»] chr4 (1 HSPs)
chr4 (75-200)||(45544585-45544710)
[»] chr2 (1 HSPs)
chr2 (78-131)||(24001040-24001093)


Alignment Details
Target: chr4 (Bit Score: 122; Significance: 9e-63; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 122; E-Value: 9e-63
Query Start/End: Original strand, 75 - 200
Target Start/End: Original strand, 45544585 - 45544710
Alignment:
Q  75 atcttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattccttcaaatcagtactcagatgttctatctgggaagattcagaac 174  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  45544585 atcttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattccttcaaatcagtactcagaagttctatctgggaagattcagaac 45544684  T
Q  175 cttggtttaattcgaatccttgatta 200  Q
    ||||||||||||||||||||||||||    
T  45544685 cttggtttaattcgaatccttgatta 45544710  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 34; Significance: 0.0000000003; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 78 - 131
Target Start/End: Original strand, 24001040 - 24001093
Alignment:
Q  78 ttggattaggttttctgccagtgatggaaaaaagaaactaaaagggattattcc 131  Q
    |||||||||||||||||| |||||||| |||| |||||||||||  ||||||||    
T  24001040 ttggattaggttttctgcgagtgatgggaaaacgaaactaaaagtaattattcc 24001093  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University