View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15850_low_5 (Length: 316)

Name: NF15850_low_5
Description: NF15850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15850_low_5
NF15850_low_5
[»] chr4 (1 HSPs)
chr4 (71-162)||(56166577-56166669)


Alignment Details
Target: chr4 (Bit Score: 85; Significance: 2e-40; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 85; E-Value: 2e-40
Query Start/End: Original strand, 71 - 162
Target Start/End: Complemental strand, 56166669 - 56166577
Alignment:
Q  71 taatccattctttccttttataaaccc-tggatcgggattgtttctctttaaatttgcgtagggcccaactactgtttctaatacaccccctc 162  Q
    ||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  56166669 taatccattctttccttttataaacccctggatcgggattgtttctctttaaatttgcgtagggcccaactactgtttctaatacaccccctc 56166577  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University