View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15850_low_11 (Length: 247)

Name: NF15850_low_11
Description: NF15850
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15850_low_11
NF15850_low_11
[»] chr1 (2 HSPs)
chr1 (4-141)||(4859824-4859960)
chr1 (191-247)||(4859718-4859774)


Alignment Details
Target: chr1 (Bit Score: 102; Significance: 9e-51; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 102; E-Value: 9e-51
Query Start/End: Original strand, 4 - 141
Target Start/End: Complemental strand, 4859960 - 4859824
Alignment:
Q  4 gatgtcgaagaatataaaacatttaaatataattttttaatctatcttctatggggacatttgtgataaggtactaaaaccagaaggcacagataaaaga 103  Q
    ||||| ||| ||||||||||||||||||||||||||||||  ||||||||||||| ||||||||||||||||||||||||||||||| ||| ||||||||    
T  4859960 gatgttgaataatataaaacatttaaatataattttttaacttatcttctatggg-acatttgtgataaggtactaaaaccagaaggtacaaataaaaga 4859862  T
Q  104 ttaataaagagcagaaataacgtaccaagttgtttcac 141  Q
    ||||||||||||||||||||||||||||||||| ||||    
T  4859861 ttaataaagagcagaaataacgtaccaagttgtctcac 4859824  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 57; E-Value: 6e-24
Query Start/End: Original strand, 191 - 247
Target Start/End: Complemental strand, 4859774 - 4859718
Alignment:
Q  191 tattaccttgataagccaaaagagtaagaatctaaggtgaccgtgacaggacataca 247  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  4859774 tattaccttgataagccaaaagagtaagaatctaaggtgaccgtgacaggacataca 4859718  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University