View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15849_high_14 (Length: 312)

Name: NF15849_high_14
Description: NF15849
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15849_high_14
NF15849_high_14
[»] chr4 (1 HSPs)
chr4 (30-143)||(39782889-39783002)


Alignment Details
Target: chr4 (Bit Score: 114; Significance: 8e-58; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 114; E-Value: 8e-58
Query Start/End: Original strand, 30 - 143
Target Start/End: Original strand, 39782889 - 39783002
Alignment:
Q  30 atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat 129  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  39782889 atcacttgatccagttgaagatgaagacaaactatgtcctgattctgaagttagtggtgtttcaattttcttgctacggttataactcgacgggcctaat 39782988  T
Q  130 gtcagctcaatttc 143  Q
    ||||||||||||||    
T  39782989 gtcagctcaatttc 39783002  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University