View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15845_high_15 (Length: 209)

Name: NF15845_high_15
Description: NF15845
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15845_high_15
NF15845_high_15
[»] chr1 (1 HSPs)
chr1 (20-192)||(40398757-40398928)
[»] chr6 (1 HSPs)
chr6 (54-98)||(24316385-24316429)


Alignment Details
Target: chr1 (Bit Score: 149; Significance: 7e-79; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 149; E-Value: 7e-79
Query Start/End: Original strand, 20 - 192
Target Start/End: Complemental strand, 40398928 - 40398757
Alignment:
Q  20 ctgttttagtgtattttgtctgttcagttctggtttgcttcatgtggggttcgataggctcgaaagggccgttaatgctcgttgtatctgttgcaagggt 119  Q
    ||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||  ||||||||||||||||||||||| ||||     
T  40398928 ctgttttagtgtattttgtttgttcagttctggtttgcttcatgtggggttcgataggctcgaaagggctattaatgctcgttgtatctgttgc-agggc 40398830  T
Q  120 tgttggttcgtgaatctatttgtgttggcaattggttcatacaccatacataaaagtaaataaaaagatcctt 192  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40398829 tgttggttcgtgaatctatttgtgttggcaattggttcatacaccatacataaaagtaaataaaaagatcctt 40398757  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 33; Significance: 0.000000001; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 54 - 98
Target Start/End: Original strand, 24316385 - 24316429
Alignment:
Q  54 ttgcttcatgtggggttcgataggctcgaaagggccgttaatgct 98  Q
    ||||||| |||||||||||||||||||||||||||  ||||||||    
T  24316385 ttgcttcgtgtggggttcgataggctcgaaagggcttttaatgct 24316429  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University