View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15842_high_11 (Length: 237)

Name: NF15842_high_11
Description: NF15842
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15842_high_11
NF15842_high_11
[»] chr8 (2 HSPs)
chr8 (38-150)||(598338-598451)
chr8 (134-202)||(597978-598046)
[»] chr4 (1 HSPs)
chr4 (133-221)||(17374497-17374585)


Alignment Details
Target: chr8 (Bit Score: 86; Significance: 3e-41; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 86; E-Value: 3e-41
Query Start/End: Original strand, 38 - 150
Target Start/End: Complemental strand, 598451 - 598338
Alignment:
Q  38 aatagagatagagattaaa-aatataagtcggtgcaatgtaatttcggaaatactcatgatatgcggtttcacgatattatgcatttttgtttatttaaa 136  Q
    |||| |||||||||||||| |||||||||||||||||||||||||  |||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  598451 aataaagatagagattaaagaatataagtcggtgcaatgtaatttttgaaatactcatgatgtgcggtttcacgatattatgcatttttgtttatttaaa 598352  T
Q  137 tacggatagtttat 150  Q
    ||||| ||||||||    
T  598351 tacgggtagtttat 598338  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 134 - 202
Target Start/End: Complemental strand, 598046 - 597978
Alignment:
Q  134 aaatacggatagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttata 202  Q
    |||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||    
T  598046 aaatacggatagtttatttaaatctttatactgagtggttgtttatggacacttatttaaatctttata 597978  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 81; Significance: 3e-38; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 81; E-Value: 3e-38
Query Start/End: Original strand, 133 - 221
Target Start/End: Complemental strand, 17374585 - 17374497
Alignment:
Q  133 taaatacggatagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttatattgagaaaaacttgaaacc 221  Q
    ||||||| | |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  17374585 taaatacaggtagtttatttaaatctttatattgagtggttgtttatggacacttatttaaatctttatattgagaaaaacttgaaacc 17374497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University