View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15840_high_19 (Length: 225)

Name: NF15840_high_19
Description: NF15840
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15840_high_19
NF15840_high_19
[»] chr1 (1 HSPs)
chr1 (14-206)||(46438174-46438370)


Alignment Details
Target: chr1 (Bit Score: 172; Significance: 1e-92; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 172; E-Value: 1e-92
Query Start/End: Original strand, 14 - 206
Target Start/End: Original strand, 46438174 - 46438370
Alignment:
Q  14 tgaagaagaaataattccactctgcaggtatataagttgaaatgttttctgctcatatagcactagttacaatgatactcaagta----tatcataaatt 109  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||    |||||||||||    
T  46438174 tgaagaagaaataattccactctgcaggtatattagttgaaatgttttctgctcatatagcactagttacaatgatactcaagtacgtatatcataaatt 46438273  T
Q  110 gtttttattgttactaagaagctttgtgtacttgcagagagcttggcattggaattgtagcatacagcccccttggtcgcggcttttttgcaggaaa 206  Q
    |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46438274 gtttttatcgttactaagaagctttgtgtacttgcagagagcttggcattggaattgtagcatacagcccccttggtcgcggcttttttgcaggaaa 46438370  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University