View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1583_high_59 (Length: 241)

Name: NF1583_high_59
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1583_high_59
NF1583_high_59
[»] chr2 (2 HSPs)
chr2 (18-152)||(32838418-32838552)
chr2 (165-241)||(32838578-32838654)


Alignment Details
Target: chr2 (Bit Score: 135; Significance: 2e-70; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 135; E-Value: 2e-70
Query Start/End: Original strand, 18 - 152
Target Start/End: Original strand, 32838418 - 32838552
Alignment:
Q  18 ccatgaatctccggtggattggtgctctgagagctccgcgaaaggggaattttggagggagataggaaggttagaacctcacggtgaaaattgaattttg 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  32838418 ccatgaatctccggtggattggtgctctgagagctccgcgaaaggggaattttggagggagataggaaggttagaacctcacggtgaaaattgaattttg 32838517  T
Q  118 aaatactacaatgcaagtgaataagtaatttccct 152  Q
    |||||||||||||||||||||||||||||||||||    
T  32838518 aaatactacaatgcaagtgaataagtaatttccct 32838552  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 49; E-Value: 4e-19
Query Start/End: Original strand, 165 - 241
Target Start/End: Original strand, 32838578 - 32838654
Alignment:
Q  165 gttaattacgttttatatttgggtcttgataacgagtgtcttgatatactagttaagaatacaaaaatgaaaataat 241  Q
    |||||||| ||||||||||||||||||| |||| |||||||| | | |||||||||| |||||||||||||||||||    
T  32838578 gttaattaggttttatatttgggtcttgttaactagtgtcttaagacactagttaaggatacaaaaatgaaaataat 32838654  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University