View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15839_low_11 (Length: 310)

Name: NF15839_low_11
Description: NF15839
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15839_low_11
NF15839_low_11
[»] chr2 (1 HSPs)
chr2 (1-298)||(42804825-42805122)


Alignment Details
Target: chr2 (Bit Score: 273; Significance: 1e-152; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 273; E-Value: 1e-152
Query Start/End: Original strand, 1 - 298
Target Start/End: Complemental strand, 42805122 - 42804825
Alignment:
Q  1 acttgatcaagacgaaggtgctattcagttaataggcttcccttcccacgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttg 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42805122 acttgatcaagacgaaggtgctattcagttaataggcttcccttcccacgtaagcatatgcgctgacaatggcaagaaatcaggatgccacctaaagttg 42805023  T
Q  101 taaacnnnnnnnttgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtcaaacct 200  Q
    |||||       ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  42805022 taaacaaaaaaattgaatgtaatttgatgggattttgaagtgaaggaaagtaaaagtgagtatgagatgcttttttcaatttggagtaagtgtgaaacct 42804923  T
Q  201 tcctttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtattttcttcga 298  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42804922 tcctttcatggaggcttgctatgagtagaaggaagaccaagtaggataggggcaatgggaccttatagaagggccattaccattagtattttcttcga 42804825  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University