View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15837_low_15 (Length: 240)

Name: NF15837_low_15
Description: NF15837
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15837_low_15
NF15837_low_15
[»] chr1 (1 HSPs)
chr1 (18-220)||(23945063-23945265)


Alignment Details
Target: chr1 (Bit Score: 162; Significance: 1e-86; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 162; E-Value: 1e-86
Query Start/End: Original strand, 18 - 220
Target Start/End: Original strand, 23945063 - 23945265
Alignment:
Q  18 aagaacggtaacaactttaatgtgggtaacggtaaaaacgaaaaatcaggaataatgatggaggagtttccgttcaaaactgatatcttgggtattaatg 117  Q
    ||||||| ||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  23945063 aagaacgataacaacattaatgtgggtaacggtaaaaacgaaaaatcaggaataatgatggaggagattccgttcaaaactgatatcttgggtattaatg 23945162  T
Q  118 gtgaaccggattctttgcatggtgagtggattaaagtggaaagnnnnnnncgagtcaataaggctgggtcacgcattgctggtgcagacatgaaaggtac 217  Q
    |||||||||||||||||||||||||||||||||||||||||||       ||||||||||||| ||| ||||||||||||||||||||||||||||||||    
T  23945163 gtgaaccggattctttgcatggtgagtggattaaagtggaaagaaaaaaacgagtcaataaggttggttcacgcattgctggtgcagacatgaaaggtac 23945262  T
Q  218 atc 220  Q
    |||    
T  23945263 atc 23945265  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University