View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15833_low_20 (Length: 201)

Name: NF15833_low_20
Description: NF15833
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15833_low_20
NF15833_low_20
[»] chr4 (3 HSPs)
chr4 (13-181)||(51155894-51156062)
chr4 (13-73)||(29938026-29938086)
chr4 (13-65)||(51144870-51144922)
[»] chr3 (1 HSPs)
chr3 (13-63)||(36285231-36285281)


Alignment Details
Target: chr4 (Bit Score: 129; Significance: 6e-67; HSPs: 3)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 129; E-Value: 6e-67
Query Start/End: Original strand, 13 - 181
Target Start/End: Complemental strand, 51156062 - 51155894
Alignment:
Q  13 gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatttggaaaatgagactcatttctatattatgtaataacaaaataaagca 112  Q
    ||||||| |||||||||||||||||||||| ||||||||||||||||| ||||  ||||||| |||||||||||||||||||||||||||||||||| ||    
T  51156062 gattatatttagttatagcttgtttctccccagtgaatgatgcaacctacattcagaaaatgggactcatttctatattatgtaataacaaaataaaaca 51155963  T
Q  113 aagtctcaatgttattttttgctaatgtacttatagttcggatgcaacctattgtctgctcaactacac 181  Q
    |||| |||||||||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||    
T  51155962 aagtttcaatgttattttttgctaatgtacttacagttcggatggaacctattgtctgctcaactacac 51155894  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #2
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 13 - 73
Target Start/End: Original strand, 29938026 - 29938086
Alignment:
Q  13 gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatttggaaaat 73  Q
    ||||||| || ||| ||||||||||||||| |||||||||||||||||| ||||| |||||    
T  29938026 gattatattttgttgtagcttgtttctccccagtgaatgatgcaacctgtatttgaaaaat 29938086  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4; HSP #3
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 13 - 65
Target Start/End: Complemental strand, 51144922 - 51144870
Alignment:
Q  13 gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgcatt 65  Q
    ||||||| |||| | |||||||||||||||  ||||| |||||||||||||||    
T  51144922 gattataattagctgtagcttgtttctccccggtgaacgatgcaacctgcatt 51144870  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 35; Significance: 0.00000000007; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 35; E-Value: 0.00000000007
Query Start/End: Original strand, 13 - 63
Target Start/End: Complemental strand, 36285281 - 36285231
Alignment:
Q  13 gattatacttagttatagcttgtttctccctagtgaatgatgcaacctgca 63  Q
    ||||||| |||| ||||||||| ||||||| ||||||||||||||||||||    
T  36285281 gattatatttagctatagcttgcttctccccagtgaatgatgcaacctgca 36285231  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University