View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15831_low_50 (Length: 250)

Name: NF15831_low_50
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15831_low_50
NF15831_low_50
[»] chr2 (1 HSPs)
chr2 (17-250)||(28805475-28805711)


Alignment Details
Target: chr2 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 17 - 250
Target Start/End: Complemental strand, 28805711 - 28805475
Alignment:
Q  17 tcatgttaaagtattatctcttccaatgtgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattgggaaagaa 116  Q
    |||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||    
T  28805711 tcatgttaaagtattatctcttccaatgcgagactcttaacgcacccactcgcacctagtattggacatctggggcgtgactaaacatattggcaaagaa 28805612  T
Q  117 agaacacaaaccttgaggataaattcctttgagaaaaacaacagaagtaatagcaacttccaaaaattcaaccaaaacccgacctattttccctgcaaca 216  Q
    |||||||||||||||||||||||| ||||| |||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| ||||||||||    
T  28805611 agaacacaaaccttgaggataaatccctttaagaaaaacaacagaggtaatagcaacttccaaaaattcaaccaaaacccgacctatttgccctgcaaca 28805512  T
Q  217 tgaat---cattcttaattagtactaaaacacaataa 250  Q
    | |||   |||||||||||||||||||||||||||||    
T  28805511 ttaataaacattcttaattagtactaaaacacaataa 28805475  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University