View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15831_low_48 (Length: 252)

Name: NF15831_low_48
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15831_low_48
NF15831_low_48
[»] chr2 (1 HSPs)
chr2 (84-252)||(28805263-28805430)


Alignment Details
Target: chr2 (Bit Score: 149; Significance: 8e-79; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 149; E-Value: 8e-79
Query Start/End: Original strand, 84 - 252
Target Start/End: Original strand, 28805263 - 28805430
Alignment:
Q  84 cccgaattgaaaacgggtcgaaattgtggtaaagttgttatttttatcgaactttatgtcctttttagaagaaggggtttcttagtttatcaagagtggg 183  Q
    ||||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||||| |||||||||||||||||||    
T  28805263 cccgatttgaaaacgggtcgaaattgtggtaaagttgttatttttatcgaactttatgacctttttagaa-aaggggttttttagtttatcaagagtggg 28805361  T
Q  184 agagaaattagaattgaaaattgaacatgggaattttttgtaatggagcgaagagagaatcaaactcca 252  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  28805362 agagaaattagaattgaaaattgaacatgggaattttttgtaatggagcgaagagagaatcaaactcca 28805430  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University