View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15831_low_37 (Length: 285)

Name: NF15831_low_37
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15831_low_37
NF15831_low_37
[»] chr2 (1 HSPs)
chr2 (123-270)||(8019366-8019513)
[»] chr6 (1 HSPs)
chr6 (75-130)||(12217255-12217309)


Alignment Details
Target: chr2 (Bit Score: 128; Significance: 3e-66; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 128; E-Value: 3e-66
Query Start/End: Original strand, 123 - 270
Target Start/End: Complemental strand, 8019513 - 8019366
Alignment:
Q  123 aggttttaactaattgcatatgattatgaaagttgttagtccttaacaattgtatgattttaggctgatatcactggtctggtatatgcacaaagtgttg 222  Q
    ||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||| |||||| |||||||||||||||||    
T  8019513 aggttttaactaattgcatatgattatgaaagttgttagtccttaacgattgtatgattttaggctaatatcactagtctggcatatgcacaaagtgttg 8019414  T
Q  223 tcgaaacttgtagcaaccagattgaagttgattgtcgatcgttaaagg 270  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||    
T  8019413 tcgaaagttgtagcaaccagattgaagttgattgtcgatcgttaaagg 8019366  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr6 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 75 - 130
Target Start/End: Original strand, 12217255 - 12217309
Alignment:
Q  75 aacttgttccacaaactatccaggtagttagttttaactaactgtaataggtttta 130  Q
    ||||||||||||||  |||| || ||||||||| ||||||||||||||||||||||    
T  12217255 aacttgttccacaagttatctag-tagttagttgtaactaactgtaataggtttta 12217309  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University