View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15831_low_29 (Length: 321)

Name: NF15831_low_29
Description: NF15831
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15831_low_29
NF15831_low_29
[»] chr5 (1 HSPs)
chr5 (17-173)||(8792884-8793040)


Alignment Details
Target: chr5 (Bit Score: 157; Significance: 2e-83; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 157; E-Value: 2e-83
Query Start/End: Original strand, 17 - 173
Target Start/End: Complemental strand, 8793040 - 8792884
Alignment:
Q  17 atgcaattttcaatctaattccctgcaaacaatccttgtcaaactgaccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgca 116  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8793040 atgcaattttcaatctaattccctgcaaacaatccttgtcaaactgaccaaatcaacttccctacatcaaaaggaactaatgcagtcccttgcgattgca 8792941  T
Q  117 atggcttatgcaacacgattctttgagaaggaatggtgaagcaaaaggtcttctctg 173  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8792940 atggcttatgcaacacgattctttgagaaggaatggtgaagcaaaaggtcttctctg 8792884  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University