View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1583-INSERTION-2 (Length: 261)

Name: NF1583-INSERTION-2
Description: NF1583
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1583-INSERTION-2
NF1583-INSERTION-2
[»] chr7 (2 HSPs)
chr7 (19-186)||(37032195-37032362)
chr7 (217-261)||(37032120-37032164)


Alignment Details
Target: chr7 (Bit Score: 168; Significance: 4e-90; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 168; E-Value: 4e-90
Query Start/End: Original strand, 19 - 186
Target Start/End: Complemental strand, 37032362 - 37032195
Alignment:
Q  19 aaaatgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggaccgttataggaatccaaaatgttaatgagggaaatgattgttaatga 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37032362 aaaatgtgagaaaaatgttaatatgatttgatggttttatgaggatggatggaccgttataggaatccaaaatgttaatgagggaaatgattgttaatga 37032263  T
Q  119 aattgaataatggaagtgaggtaaggaaatatagccgttgggttgagatcttgttgtaaaggacttga 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37032262 aattgaataatggaagtgaggtaaggaaatatagccgttgggttgagatcttgttgtaaaggacttga 37032195  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 37; E-Value: 0.000000000006
Query Start/End: Original strand, 217 - 261
Target Start/End: Complemental strand, 37032164 - 37032120
Alignment:
Q  217 ggctgtattggcattttgactaggcaacaacgcatggcatgtgga 261  Q
    ||||||||||| |||||||||||||||||| ||||||||||||||    
T  37032164 ggctgtattggtattttgactaggcaacaaggcatggcatgtgga 37032120  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University