View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15824_low_12 (Length: 216)

Name: NF15824_low_12
Description: NF15824
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15824_low_12
NF15824_low_12
[»] chr2 (1 HSPs)
chr2 (19-198)||(7247200-7247379)


Alignment Details
Target: chr2 (Bit Score: 180; Significance: 2e-97; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 180; E-Value: 2e-97
Query Start/End: Original strand, 19 - 198
Target Start/End: Complemental strand, 7247379 - 7247200
Alignment:
Q  19 tcgaatacgctcttgtttacggcgattataaaggcgtaccgaagagtcagattagggagtttatggcgaagggatgtgatgttgttttgagagttgatat 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7247379 tcgaatacgctcttgtttacggcgattataaaggcgtaccgaagagtcagattagggagtttatggcgaagggatgtgatgttgttttgagagttgatat 7247280  T
Q  119 tcaaggtgcggagacattgaggaaggttttggggaaatcggcggtttttgtgtttttgatggcggagagtgaaatggcga 198  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7247279 tcaaggtgcggagacattgaggaaggttttggggaaatcggcggtttttgtgtttttgatggcggagagtgaaatggcga 7247200  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University