View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15823_low_59 (Length: 205)

Name: NF15823_low_59
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15823_low_59
NF15823_low_59
[»] chr8 (1 HSPs)
chr8 (19-182)||(42623289-42623452)


Alignment Details
Target: chr8 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 19 - 182
Target Start/End: Complemental strand, 42623452 - 42623289
Alignment:
Q  19 ctacaaaccctaattttgatctgtgtaacggttaacatggcttcttctggacacttcaagttgttgaagaggaaattcgatggcaccgtcgttcaaatcg 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  42623452 ctacaaaccctaattttgatctgtgtaacggttaacatggcttcttctggacacttcaagttgttgaagaggaaactcgatggcaccgtcgttcaaatcg 42623353  T
Q  119 gtgacgatttctccgatttctctctttcttctccggctactaaaattcgccgcctcgtacgtac 182  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  42623352 gtgacgatttctccgatttctctctttcttctccggctactaaaattcgccgcctcgtacgtac 42623289  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University