View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15823_low_55 (Length: 228)

Name: NF15823_low_55
Description: NF15823
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15823_low_55
NF15823_low_55
[»] chr3 (2 HSPs)
chr3 (69-212)||(46633533-46633676)
chr3 (19-66)||(46633436-46633483)


Alignment Details
Target: chr3 (Bit Score: 120; Significance: 2e-61; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 120; E-Value: 2e-61
Query Start/End: Original strand, 69 - 212
Target Start/End: Original strand, 46633533 - 46633676
Alignment:
Q  69 atttttagcttcagcaaaataaagtaaattttagcgcataaaattgatttagcaagaaacagatagtttaaaagctttgttaagtttaataattttggaa 168  Q
    |||||| |||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||    
T  46633533 atttttggcttcagcaaaataaactaaattttagcgcataaaattgatttagcaagaaacagatagtttaaaggctttgttgagtttaataattttggaa 46633632  T
Q  169 gtcatctcaccatttatttgctttgcaaaagctttaaacctttg 212  Q
    ||| | ||||||||||||||||||||||||||||||||||||||    
T  46633633 gtcctatcaccatttatttgctttgcaaaagctttaaacctttg 46633676  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 40; E-Value: 0.00000000000008
Query Start/End: Original strand, 19 - 66
Target Start/End: Original strand, 46633436 - 46633483
Alignment:
Q  19 aaattacagtgcaaaatttagtatttgtttgatttcacgttgcaaact 66  Q
    ||||||||||||||||||||||| || |||||||||||||||||||||    
T  46633436 aaattacagtgcaaaatttagtacttatttgatttcacgttgcaaact 46633483  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University