View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15821_high_16 (Length: 202)

Name: NF15821_high_16
Description: NF15821
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15821_high_16
NF15821_high_16
[»] chr8 (14 HSPs)
chr8 (14-185)||(6425208-6425379)
chr8 (14-185)||(6290426-6290597)
chr8 (14-185)||(6275674-6275845)
chr8 (14-187)||(6353516-6353689)
chr8 (14-158)||(6371249-6371393)
chr8 (14-187)||(6392012-6392185)
chr8 (14-185)||(6333102-6333273)
chr8 (14-185)||(6364391-6364562)
chr8 (14-185)||(7460590-7460761)
chr8 (14-187)||(6411176-6411349)
chr8 (11-185)||(6322535-6322709)
chr8 (18-107)||(6264927-6265016)
chr8 (11-99)||(6452174-6452262)
chr8 (11-104)||(6458262-6458355)
[»] chr2 (2 HSPs)
chr2 (11-101)||(42694394-42694484)
chr2 (11-101)||(42687173-42687263)
[»] chr3 (2 HSPs)
chr3 (28-104)||(36743945-36744021)
chr3 (31-99)||(35722304-35722372)


Alignment Details
Target: chr8 (Bit Score: 168; Significance: 3e-90; HSPs: 14)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 168; E-Value: 3e-90
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 6425379 - 6425208
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6425379 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 6425280  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    ||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  6425279 ctcgaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 6425208  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 100; E-Value: 1e-49
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 6290597 - 6290426
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| ||||||||||||||||||||||||| |||||||||||||||||||||||| || |||||||||||||||||||||||||| |||||||||||    
T  6290597 aagaagaattgaagactttaagaggagatggaacaggagagcgcaaggaatgggaaagaatatatgattacgatgtctacaatgatttaggtgagcctga 6290498  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    ||| ||||||   ||||  |||| | ||||||| ||||||||||  || ||||||||||||||||| |||||    
T  6290497 ctcgaaacctcaattggcgcgtcaaattcttgggggatcgagcaatttcccttaccctcgaaggggaagaac 6290426  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #3
Raw Score: 96; E-Value: 3e-47
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 6275845 - 6275674
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||||||||| ||||||||||||||||||| ||||||||| || |||||||||||||||||||| |||||||||||||||||| ||||||| |||||    
T  6275845 aagaagagttgaacactttaagaggagatggaacaggagagcgtaaagaatgggaaaggatctatgactacgatgtctacaatgatgtgggtgatcctga 6275746  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    |   ||| | | ||||| |||||| ||| |||||||||| | ||||||||||||||||||||| ||||||||    
T  6275745 caagaaagcaagcttggctcgtcccgttattggaggatccaacaccttgccttaccctcgaagagggagaac 6275674  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #4
Raw Score: 94; E-Value: 4e-46
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 6353689 - 6353516
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| |||||||||||||||||||||||||  ||||||||||||||||||||||| || ||||||||||||||||||||||||||||||||||||||    
T  6353689 aagaagaattgaagactttaagaggagatggaactggagagcgcaaggaatgggaaagaatatatgattacgatgtctacaatgatttgggtgagcctga 6353590  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaactg 187  Q
    ||| ||||||   ||||  |||| | ||||||| ||||| |||   || ||||||||||||||||| |||||||    
T  6353589 ctcgaaacctcaattggcgcgtcaaattcttgggggatcaagcgatttcccttaccctcgaaggggaagaactg 6353516  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #5
Raw Score: 77; E-Value: 6e-36
Query Start/End: Original strand, 14 - 158
Target Start/End: Complemental strand, 6371393 - 6371249
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    |||||||||||||||||||||||||||||||||  || |||||||| |||||||| ||||||||||| |||||||||||||||||||||||||| || ||    
T  6371393 aagaagagttgaagactttaagaggagatggaacgggtgagcgcaaagaatgggataggatctatgactacgatgtctacaatgatttgggtgaaccaga 6371294  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcac 158  Q
    |  | |  ||  ||||||||||||||||||||| ||||| |||||    
T  6371293 caaagaggctggcttgggtcgtccagttcttgggggatcaagcac 6371249  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #6
Raw Score: 74; E-Value: 4e-34
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 6392185 - 6392012
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| ||||| |||||||||||||||||||  |||||||| ||||||||||| || || |||||||| ||||||||||||||||||||| | || ||    
T  6392185 aagaagaattgaatactttaagaggagatggaactggagagcgtaaggaatgggacagaatatatgattatgatgtctacaatgatttgggtcaaccaga 6392086  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaactg 187  Q
    |  ||| |||  ||||  ||||||||||||||| ||||| |   |||||||||||||||||||||| |||||||    
T  6392085 ccaaaatccttgcttgtatcgtccagttcttgggggatcaactgccttgccttaccctcgaaggggaagaactg 6392012  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #7
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 6333273 - 6333102
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| |||||||||||||||||||||||||  || |||||||| |||| ||| ||||||||||| |||||||| |||||||| |||||||| |||||    
T  6333273 aagaagaattgaagactttaagaggagatggaacgggtgagcgcaaagaatcggataggatctatgactacgatgtttacaatgacttgggtgatcctga 6333174  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    |   |||   | ||||| |||||| ||| |||||||||| |  | |||||||||||||||||||||||||||    
T  6333173 caagaaagaaagcttggctcgtcccgttgttggaggatccaataacttgccttaccctcgaagggggagaac 6333102  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #8
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 6364562 - 6364391
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| |||||||||||||||||||||||||  |||||||| |||||||||||||| || |||||||| |||||||||||||||||||||||    ||    
T  6364562 aagaagaattgaagactttaagaggagatggaactggagagcgtaaggaatgggaaagaatatatgattatgatgtctacaatgatttgggtgatgtgga 6364463  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    |   ||  |||  |||| |||||| ||| |||||||||| |||||| | |||||||||||||| ||||||||    
T  6364462 caagaacgctagtttggctcgtcctgttgttggaggatctagcaccctcccttaccctcgaagagggagaac 6364391  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #9
Raw Score: 72; E-Value: 6e-33
Query Start/End: Original strand, 14 - 185
Target Start/End: Complemental strand, 7460761 - 7460590
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| |||||||||||||||||||||||||  |||||||||||||||||||| || || |||||||| |||||||||||||| |||||||| || ||    
T  7460761 aagaagaattgaagactttaagaggagatggaacgggagagcgcaaggaatgggacagaatatatgattatgatgtctacaatgacttgggtgatcccga 7460662  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    |   ||| ||| ||||| |||||| |||  ||||||| |  | | ||||||||||||||||||||| |||||    
T  7460661 ccagaaagctagcttggctcgtcctgttgctggaggacctggaaacttgccttaccctcgaaggggaagaac 7460590  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #10
Raw Score: 70; E-Value: 9e-32
Query Start/End: Original strand, 14 - 187
Target Start/End: Complemental strand, 6411349 - 6411176
Alignment:
Q  14 aagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcctga 113  Q
    ||||||| |||||||||||||||||||||||||  |||||||| |||| |||||| || || |||||||| ||||||||||||||||||||| | || ||    
T  6411349 aagaagaattgaagactttaagaggagatggaactggagagcgtaaggtatgggacagaatatatgattatgatgtctacaatgatttgggtcaaccaga 6411250  T
Q  114 ctcaaaacctaccttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaactg 187  Q
    |  ||  |||  ||||  ||||||||||||||| |||||   | |||||||||||||||||||||| |||||||    
T  6411249 cgaaagtccttgcttgtatcgtccagttcttgggggatcagccgccttgccttaccctcgaaggggaagaactg 6411176  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #11
Raw Score: 56; E-Value: 2e-23
Query Start/End: Original strand, 11 - 185
Target Start/End: Complemental strand, 6322709 - 6322535
Alignment:
Q  11 gagaagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtgagcc 110  Q
    |||||||||| |||||||||||||||||||||||||  ||  |||||||||||   || || |||||||| |||||||| |||||||| |||||||| ||    
T  6322709 gagaagaagaattgaagactttaagaggagatggaacgggtcagcgcaaggaacacgatagaatctatgactacgatgtttacaatgacttgggtgatcc 6322610  T
Q  111 tgactcaaaacctac-cttgggtcgtccagttcttggaggatcgagcaccttgccttaccctcgaagggggagaac 185  Q
    ||||  |  ||  || ||||| |||||| ||| ||||||||||   |||||||||||||||||||||||| |||||    
T  6322609 tgac-aagtacgcacacttggctcgtcccgttattggaggatccgacaccttgccttaccctcgaaggggcagaac 6322535  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #12
Raw Score: 50; E-Value: 8e-20
Query Start/End: Original strand, 18 - 107
Target Start/End: Complemental strand, 6265016 - 6264927
Alignment:
Q  18 agagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttgggtga 107  Q
    |||||||||||||||||||||||||||||  || |||||||| |||||||| ||  | |||||||| ||||| |||||||||||||||||    
T  6265016 agagttgaagactttaagaggagatggaacgggggagcgcaaagaatgggacagagtttatgattatgatgtttacaatgatttgggtga 6264927  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #13
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 11 - 99
Target Start/End: Complemental strand, 6452262 - 6452174
Alignment:
Q  11 gagaagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgat 99  Q
    |||||||||||||| ||| | |||||||||||||||  ||||| ||||| |||||||| ||||| || ||||| ||||| || ||||||    
T  6452262 gagaagaagagttgcagaatctaagaggagatggaaccggagaacgcaaagaatgggataggatatacgattatgatgtttataatgat 6452174  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #14
Raw Score: 34; E-Value: 0.0000000003
Query Start/End: Original strand, 11 - 104
Target Start/End: Complemental strand, 6458355 - 6458262
Alignment:
Q  11 gagaagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttggg 104  Q
    |||||||||||||| ||||| |||||||||||||||  ||||||||||| |||  ||| ||  | |||||||| ||| | || |||||||||||    
T  6458355 gagaagaagagttgcagactctaagaggagatggaactggagagcgcaaagaagcggatagagtttatgattatgatatttataatgatttggg 6458262  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2 (Bit Score: 59; Significance: 3e-25; HSPs: 2)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 59; E-Value: 3e-25
Query Start/End: Original strand, 11 - 101
Target Start/End: Complemental strand, 42694484 - 42694394
Alignment:
Q  11 gagaagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgattt 101  Q
    |||||||||| ||||| | ||||||||||||||||| |||||| ||||| ||||||||||| ||||||||||| |||||||||||||||||    
T  42694484 gagaagaagaattgaacaatttaagaggagatggaacaggagaacgcaaagaatgggaaagaatctatgattatgatgtctacaatgattt 42694394  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr2; HSP #2
Raw Score: 43; E-Value: 0.000000000000001
Query Start/End: Original strand, 11 - 101
Target Start/End: Original strand, 42687173 - 42687263
Alignment:
Q  11 gagaagaagagttgaagactttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgattt 101  Q
    |||||||||| ||| | | |||||| |||||||||| |||||||||||||  |   ||||||||||| |||||||||||||||||||||||    
T  42687173 gagaagaagaattgcaaaatttaaggggagatggaacaggagagcgcaagttacatgaaaggatctacgattacgatgtctacaatgattt 42687263  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 37; Significance: 0.000000000004; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 37; E-Value: 0.000000000004
Query Start/End: Original strand, 28 - 104
Target Start/End: Original strand, 36743945 - 36744021
Alignment:
Q  28 actttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgatttggg 104  Q
    |||||||| |||||||||| || | ||||  |||||||||| || ||||||||||| ||||| ||||||||||||||    
T  36743945 actttaaggggagatggaacagcaaagcgtgaggaatgggacagaatctatgattatgatgtttacaatgatttggg 36744021  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 33; E-Value: 0.000000001
Query Start/End: Original strand, 31 - 99
Target Start/End: Original strand, 35722304 - 35722372
Alignment:
Q  31 ttaagaggagatggaaaaggagagcgcaaggaatgggaaaggatctatgattacgatgtctacaatgat 99  Q
    ||||||||| ||||| |||||||||| ||| |||  || || ||||||||||| |||||||||||||||    
T  35722304 ttaagaggaaatggagaaggagagcgtaagaaatcagacagaatctatgattatgatgtctacaatgat 35722372  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University