View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1581_high_1 (Length: 412)

Name: NF1581_high_1
Description: NF1581
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1581_high_1
NF1581_high_1
[»] chr1 (2 HSPs)
chr1 (58-140)||(27985981-27986063)
chr1 (14-64)||(27985899-27985949)


Alignment Details
Target: chr1 (Bit Score: 67; Significance: 1e-29; HSPs: 2)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 67; E-Value: 1e-29
Query Start/End: Original strand, 58 - 140
Target Start/End: Original strand, 27985981 - 27986063
Alignment:
Q  58 caaacttctcttgtgcagtgtttgggaatatgcagtggaagttcgaacttcaaattctagaagatcttgccccagttcctttt 140  Q
    ||||||||||||||||||||||||||||| || |||||||||||||| |||||||||||||||||||||||| ||||||||||    
T  27985981 caaacttctcttgtgcagtgtttgggaatgtgtagtggaagttcgaatttcaaattctagaagatcttgccctagttcctttt 27986063  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1; HSP #2
Raw Score: 47; E-Value: 1e-17
Query Start/End: Original strand, 14 - 64
Target Start/End: Original strand, 27985899 - 27985949
Alignment:
Q  14 agaaggtggtgctggtggatatattgtcattctcatgtctcacacaaactt 64  Q
    ||||||||||||||||| |||||||||||||||||||||||||||||||||    
T  27985899 agaaggtggtgctggtgtatatattgtcattctcatgtctcacacaaactt 27985949  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University