View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15811_high_3 (Length: 203)

Name: NF15811_high_3
Description: NF15811
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15811_high_3
NF15811_high_3
[»] chr4 (1 HSPs)
chr4 (16-187)||(37249497-37249669)


Alignment Details
Target: chr4 (Bit Score: 157; Significance: 1e-83; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 157; E-Value: 1e-83
Query Start/End: Original strand, 16 - 187
Target Start/End: Complemental strand, 37249669 - 37249497
Alignment:
Q  16 aatattgtgatattttccaccatgcacttaagatttaatactatctctatgcattttcttagatcaccctaggatctttacactcaatttccttttaacc 115  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  37249669 aatattgtgatattttccaccatgcacttaagatttaatactatctctatgcattttcttagatcaccctaggatctttacactcaatttccttttaacc 37249570  T
Q  116 acttcgactttacaaccttggtttggcaa-attgcctttacacttcttaattacgctttcaatgagtaactag 187  Q
    |||||||||||||||||||| ||||||||  ||||||||||||||||||||||||||||||||||||||||||    
T  37249569 acttcgactttacaaccttgatttggcaaccttgcctttacacttcttaattacgctttcaatgagtaactag 37249497  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University