View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15800_high_11 (Length: 262)

Name: NF15800_high_11
Description: NF15800
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15800_high_11
NF15800_high_11
[»] chr6 (1 HSPs)
chr6 (1-251)||(14918706-14918957)
[»] chr5 (2 HSPs)
chr5 (1-157)||(38126288-38126443)
chr5 (2-112)||(38118171-38118281)
[»] chr3 (1 HSPs)
chr3 (10-65)||(35469009-35469064)


Alignment Details
Target: chr6 (Bit Score: 220; Significance: 1e-121; HSPs: 1)
Name: chr6
Description:

Target: chr6; HSP #1
Raw Score: 220; E-Value: 1e-121
Query Start/End: Original strand, 1 - 251
Target Start/End: Original strand, 14918706 - 14918957
Alignment:
Q  1 ctttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct 100  Q
    |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14918706 ctttttggttttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct 14918805  T
Q  101 tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagtcgcatgattgttgcttctttgctgcgatcaaatgtgta-tatatgttc 199  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||  |||||||||||||||||| ||||||||||||||||| |||||||||    
T  14918806 tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagttacatgattgttgcttcttttctgcgatcaaatgtgtattatatgttc 14918905  T
Q  200 ttttagatgccttgacattttttcttatatgacatgtgcgtattcatctctc 251  Q
    ||||||||||||||||||||||||||||||| ||||||||||||||| ||||    
T  14918906 ttttagatgccttgacattttttcttatatgccatgtgcgtattcatgtctc 14918957  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5 (Bit Score: 89; Significance: 6e-43; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 89; E-Value: 6e-43
Query Start/End: Original strand, 1 - 157
Target Start/End: Original strand, 38126288 - 38126443
Alignment:
Q  1 ctttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatct 100  Q
    ||||||||  ||||||||||||||||||||| ||||||||| |||||||||||||||||||| ||||||||| ||||||| ||||  |||||||||||||    
T  38126288 ctttttggtattgcaggaactgttgtggacagcaaaatttgccatcctaggaattatgatttttatatgtgtgctcatgctggaatgattgtgagtatct 38126387  T
Q  101 tctactcttttttccgatgatgatcatttcagttgagctttatttttgaagtcgcat 157  Q
    ||||||| |||||| ||||||| ||||||||| |||||||  |||||||||| ||||    
T  38126388 tctactc-tttttctgatgatgttcatttcagctgagcttgctttttgaagttgcat 38126443  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 2 - 112
Target Start/End: Original strand, 38118171 - 38118281
Alignment:
Q  2 tttttggctttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttctatatgtgttctcatgcaggaagaattgtgagtatctt 101  Q
    ||||||| |||||||| |||||||||||||||||||| ||||||||  |||||||||||||||| |||||| ||||||| ||||  ||||||||||||||    
T  38118171 tttttggttttgcaggtactgttgtggacaacaaaatctgtcatccccggaattatgatttctacatgtgtgctcatgctggaatgattgtgagtatctt 38118270  T
Q  102 ctactcttttt 112  Q
    |||||||||||    
T  38118271 ctactcttttt 38118281  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 10 - 65
Target Start/End: Original strand, 35469009 - 35469064
Alignment:
Q  10 tttgcaggaactgttgtggacaacaaaatttgtcatcctaggaattatgatttcta 65  Q
    ||||||||||||||| | ||||| |||||||||||||| || || |||||||||||    
T  35469009 tttgcaggaactgttatcgacaataaaatttgtcatccaagaaactatgatttcta 35469064  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University