View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1579_high_60 (Length: 244)

Name: NF1579_high_60
Description: NF1579
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1579_high_60
NF1579_high_60
[»] chr3 (1 HSPs)
chr3 (89-235)||(25941343-25941489)


Alignment Details
Target: chr3 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 89 - 235
Target Start/End: Original strand, 25941343 - 25941489
Alignment:
Q  89 gaggggtttctgggatcatggcatccagggacagttattgatagtgagaagctgaagcgtcatgttcaatatgagaatattctgaatgataatggattgg 188  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  25941343 gaggggtttctgggatcatggcatccagggacagttattgatagtgagaagctgaagcgtcatgttcaatatgagaatattctgaatgataatggattgg 25941442  T
Q  189 gtaattttgtggagatagtgagtgtttcaagtgttttggatgatgat 235  Q
    |||||||||||||||||||||||||||||||||||||||||| ||||    
T  25941443 gtaattttgtggagatagtgagtgtttcaagtgttttggatggtgat 25941489  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University