View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15797_low_9 (Length: 227)

Name: NF15797_low_9
Description: NF15797
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15797_low_9
NF15797_low_9
[»] chr5 (1 HSPs)
chr5 (18-209)||(7281150-7281341)


Alignment Details
Target: chr5 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 18 - 209
Target Start/End: Original strand, 7281150 - 7281341
Alignment:
Q  18 taaaggaagactcaatttgccagattttagacaaaattaagtgtctctcctattggtagctaaaagcaaaaaatattacttttgcttttgggtatgagca 117  Q
    |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  7281150 taaaggaagactcaatttgccagattttagacaaaattaattgtctctcctattggtagctaaaagcaaaaaatattacttttgcttttgggtatgagca 7281249  T
Q  118 ccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcatgtttcattttttgttgtatcattgaaataaacttct 209  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||    
T  7281250 ccggtggtctagtcctttactttgcttaggcaatgggttttagctctctttctcctgtttcattttttgttgtatcattgaaataaacttct 7281341  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University