View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF1578_high_5 (Length: 219)

Name: NF1578_high_5
Description: NF1578
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF1578_high_5
NF1578_high_5
[»] chr2 (1 HSPs)
chr2 (125-215)||(2796959-2797048)


Alignment Details
Target: chr2 (Bit Score: 62; Significance: 6e-27; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 62; E-Value: 6e-27
Query Start/End: Original strand, 125 - 215
Target Start/End: Complemental strand, 2797048 - 2796959
Alignment:
Q  125 gaaatctaagacaacccttttggttttgcttaatgggttttcagaaaatagaagaaagatggnnnnnnnacgttgttgttgttgttggtgg 215  Q
    ||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||       ||||||||||||||||||||||    
T  2797048 gaaatctaagacaacccttttggttttgcttaatggg-tttcagaaaatagaagaaagatggtttttttacgttgttgttgttgttggtgg 2796959  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University