View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15789_low_27 (Length: 388)

Name: NF15789_low_27
Description: NF15789
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15789_low_27
NF15789_low_27
[»] chr2 (1 HSPs)
chr2 (241-280)||(5461181-5461220)
[»] chr3 (1 HSPs)
chr3 (194-226)||(14782794-14782826)
[»] chr1 (1 HSPs)
chr1 (196-224)||(33598479-33598507)


Alignment Details
Target: chr2 (Bit Score: 32; Significance: 0.000000009; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 32; E-Value: 0.000000009
Query Start/End: Original strand, 241 - 280
Target Start/End: Original strand, 5461181 - 5461220
Alignment:
Q  241 atgtgattacattcaattaatttattattccaaattatta 280  Q
    ||||||||||||||||||||||||||||  ||||||||||    
T  5461181 atgtgattacattcaattaatttattatctcaaattatta 5461220  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 194 - 226
Target Start/End: Original strand, 14782794 - 14782826
Alignment:
Q  194 atctctgtagcaccgacacttctgattgaaagc 226  Q
    |||||||||||||||||||||||||| ||||||    
T  14782794 atctctgtagcaccgacacttctgatggaaagc 14782826  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr1 (Bit Score: 29; Significance: 0.0000005; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 196 - 224
Target Start/End: Complemental strand, 33598507 - 33598479
Alignment:
Q  196 ctctgtagcaccgacacttctgattgaaa 224  Q
    |||||||||||||||||||||||||||||    
T  33598507 ctctgtagcaccgacacttctgattgaaa 33598479  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University