View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15786_high_5 (Length: 398)

Name: NF15786_high_5
Description: NF15786
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15786_high_5
NF15786_high_5
[»] chr8 (2 HSPs)
chr8 (31-186)||(2661020-2661175)
chr8 (261-398)||(2661253-2661390)
[»] chr7 (2 HSPs)
chr7 (269-394)||(25951995-25952117)
chr7 (274-394)||(25945404-25945521)


Alignment Details
Target: chr8 (Bit Score: 152; Significance: 2e-80; HSPs: 2)
Name: chr8
Description:

Target: chr8; HSP #1
Raw Score: 152; E-Value: 2e-80
Query Start/End: Original strand, 31 - 186
Target Start/End: Original strand, 2661020 - 2661175
Alignment:
Q  31 ataggcctggtttagggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga 130  Q
    ||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2661020 ataggcctggttttgggttaggttttgggtcggctagtgtatcggggtctggtctaggatttaattctggtcgtggtgtgaatggttcagataggaatga 2661119  T
Q  131 tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 186  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  2661120 tgatgaatctgatgagaatgataatcgggatgataaatttttgcctactgcgtttg 2661175  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr8; HSP #2
Raw Score: 134; E-Value: 1e-69
Query Start/End: Original strand, 261 - 398
Target Start/End: Original strand, 2661253 - 2661390
Alignment:
Q  261 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttata 360  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||    
T  2661253 ccggggatgggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacaaagggaattggaatgaagctgcttgagaagatgggttata 2661352  T
Q  361 aagggggtggtcttgggaagaatgagcagggtatttta 398  Q
    ||||||||||||||||||||||||||||||||||||||    
T  2661353 aagggggtggtcttgggaagaatgagcagggtatttta 2661390  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7 (Bit Score: 64; Significance: 7e-28; HSPs: 2)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 64; E-Value: 7e-28
Query Start/End: Original strand, 269 - 394
Target Start/End: Original strand, 25951995 - 25952117
Alignment:
Q  269 gggtttaggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggt 368  Q
    |||| ||||||||||||| || || ||||||||||||||| ||||| |||   | ||||| |||||||||||| | ||||| |||||||||||||| |||    
T  25951995 gggtctaggtcaggagggatcagttgatgttgggaaattcaagagttata---acggaatgggaatgaagctgatggagaaaatgggttataaaggaggt 25952091  T
Q  369 ggtcttgggaagaatgagcagggtat 394  Q
    ||||||||||||||||||||||||||    
T  25952092 ggtcttgggaagaatgagcagggtat 25952117  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 54; E-Value: 7e-22
Query Start/End: Original strand, 274 - 394
Target Start/End: Original strand, 25945404 - 25945521
Alignment:
Q  274 taggtcaggaggggtctgtggatgttgggaaattcgagagtcatacgaagggaattggaatgaagctgcttgagaagatgggttataaagggggtggtct 373  Q
    ||||||| ||||  || ||||||||||||||||| |||| |  ||| || ||||| |||||||||||| | ||||| |||||||||||||| ||||||||    
T  25945404 taggtcacgaggaatcagtggatgttgggaaattggagaat--tac-aacggaatgggaatgaagctgatggagaaaatgggttataaaggaggtggtct 25945500  T
Q  374 tgggaagaatgagcagggtat 394  Q
    |||||||||||||||||||||    
T  25945501 tgggaagaatgagcagggtat 25945521  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University