View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15783_high_13 (Length: 214)

Name: NF15783_high_13
Description: NF15783
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15783_high_13
NF15783_high_13
[»] chr7 (1 HSPs)
chr7 (16-194)||(7729740-7729918)


Alignment Details
Target: chr7 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 194
Target Start/End: Complemental strand, 7729918 - 7729740
Alignment:
Q  16 atgaaaggctttctgaagtcaaagagagctagtaccggtgcaaacgtgatagctagcttgagagcttgtaaggcttcagttgtagagggactccatacga 115  Q
    |||||||||||| |||||||| |||||||||||||| ||||| ||||||||||||||||||||||||||||||||||||||||||||| |||||||||||    
T  7729918 atgaaaggctttgtgaagtcagagagagctagtaccagtgcagacgtgatagctagcttgagagcttgtaaggcttcagttgtagaggaactccatacga 7729819  T
Q  116 atgcttccttcttcaagattttagttaatggagtggtaattgtggaataatggcacacaaatcttctatagtaaccgga 194  Q
    | |||||||||||||||| |||||||||||||| ||||||||| |||||||||||||||||||||||||||||||||||    
T  7729818 acgcttccttcttcaagagtttagttaatggagcggtaattgtagaataatggcacacaaatcttctatagtaaccgga 7729740  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University