View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15778_low_7 (Length: 311)

Name: NF15778_low_7
Description: NF15778
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15778_low_7
NF15778_low_7
[»] chr3 (2 HSPs)
chr3 (158-293)||(8140443-8140580)
chr3 (27-111)||(8140370-8140454)


Alignment Details
Target: chr3 (Bit Score: 127; Significance: 1e-65; HSPs: 2)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 127; E-Value: 1e-65
Query Start/End: Original strand, 158 - 293
Target Start/End: Original strand, 8140443 - 8140580
Alignment:
Q  158 ttgatgtggtccatgcacaaggatga--cacacaaattgagagaaataaattttatgtggtcctaattgcatgttataggtagttgtgataatatcagaa 255  Q
    ||||||||||||||||||||||||||  ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  8140443 ttgatgtggtccatgcacaaggatgagacacacaaattgagagaaataaattttatgtggtcctaattgcatgttataggtagttgtgataatatcagaa 8140542  T
Q  256 ctaatattacatttgttaacatttttgttatatactac 293  Q
    ||||||||||||||||||||||||||||||||||||||    
T  8140543 ctaatattacatttgttaacatttttgttatatactac 8140580  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 27 - 111
Target Start/End: Original strand, 8140370 - 8140454
Alignment:
Q  27 agatgatatttgaaatagtaatctcagccacattgcaataattgatattgtagacaattattctcaattatagttgatgtggtcc 111  Q
    |||||||||||||||||||||||| ||||||||||||||||||||||||||||||||| ||||||||||||| ||||||||||||    
T  8140370 agatgatatttgaaatagtaatcttagccacattgcaataattgatattgtagacaatcattctcaattataattgatgtggtcc 8140454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University