View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15777_low_57 (Length: 237)

Name: NF15777_low_57
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15777_low_57
NF15777_low_57
[»] chr1 (1 HSPs)
chr1 (67-222)||(14132818-14132973)


Alignment Details
Target: chr1 (Bit Score: 140; Significance: 2e-73; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 140; E-Value: 2e-73
Query Start/End: Original strand, 67 - 222
Target Start/End: Complemental strand, 14132973 - 14132818
Alignment:
Q  67 gattgtttagtaaattggatttttatgggatgtttaagattttattagcaaatttttaacatgaaaagatctttaatgaaaacatcaaataaaagagtgt 166  Q
    |||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  14132973 gattgtttagtaaattggatttatatgggatgtttaagattttattagcaaatttttaacatgaaaagatctttaatgaaaacatcaaataaaagagtgt 14132874  T
Q  167 gttttgaaatttgtttttaagggcgtgtattgagaatataatgaaataaagtgtgt 222  Q
    ||||||||||||||||| |||||||||||| ||||||||||||||||||| |||||    
T  14132873 gttttgaaatttgttttcaagggcgtgtatcgagaatataatgaaataaaatgtgt 14132818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University