View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15777_low_23 (Length: 407)

Name: NF15777_low_23
Description: NF15777
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15777_low_23
NF15777_low_23
[»] chr4 (1 HSPs)
chr4 (8-127)||(49495397-49495516)


Alignment Details
Target: chr4 (Bit Score: 112; Significance: 2e-56; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 112; E-Value: 2e-56
Query Start/End: Original strand, 8 - 127
Target Start/End: Complemental strand, 49495516 - 49495397
Alignment:
Q  8 tagcatagggcaactagaattttgaatgtaatcacaattcaaaacatagcattatctgtgtagttttcttttgtatggatgttgtgaaacatgacatcta 107  Q
    |||||| ||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  49495516 tagcattgggcaactagaattttgaatgtaatcacaattctaaacatagcattatctgtgtagttttcttttgtatggatgttgtgaaacatgacatcta 49495417  T
Q  108 ttgaagggggagagagaaaa 127  Q
    ||||||||||||||||||||    
T  49495416 ttgaagggggagagagaaaa 49495397  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University