View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15762_high_18 (Length: 208)

Name: NF15762_high_18
Description: NF15762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15762_high_18
NF15762_high_18
[»] chr2 (1 HSPs)
chr2 (104-192)||(43164431-43164519)


Alignment Details
Target: chr2 (Bit Score: 85; Significance: 1e-40; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 85; E-Value: 1e-40
Query Start/End: Original strand, 104 - 192
Target Start/End: Complemental strand, 43164519 - 43164431
Alignment:
Q  104 ggttatgaaattcattaatatgattgaagactataaaaagttaaagtgaaaactactaaactaaaggatgatcaacatatgtatttcat 192  Q
    |||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  43164519 ggttatgaaatttattaatatgattgaagactataaaaagttaaagtgaaaactactaaactaaaggatgatcaacatatgtatttcat 43164431  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University