View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15762_high_17 (Length: 218)

Name: NF15762_high_17
Description: NF15762
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15762_high_17
NF15762_high_17
[»] chr1 (1 HSPs)
chr1 (1-195)||(3482624-3482818)


Alignment Details
Target: chr1 (Bit Score: 167; Significance: 1e-89; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 167; E-Value: 1e-89
Query Start/End: Original strand, 1 - 195
Target Start/End: Original strand, 3482624 - 3482818
Alignment:
Q  1 ttttttccatgatgacttttggatggggttttcgactctatttacttgtgatctttaccaccaaactgatctctatcaccattaaaattgcattattctt 100  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||    
T  3482624 ttttttccatgatgacttttggatggggttttcgactctatttacttgtgatctttaccaccaaactgatctctaccaccattaaaattgcattattctt 3482723  T
Q  101 gtatgatgattgtttaatagatctcttaatttgctcaatcgatcgaatcgtaacttttgatcggctttttcataaatgtcaccaattatgagggg 195  Q
    ||||||||||||||||||||| |||||||||||||||||||||   ||||||| |||| ||||||||||||||||||||||||||||||||||||    
T  3482724 gtatgatgattgtttaatagacctcttaatttgctcaatcgatgagatcgtaatttttaatcggctttttcataaatgtcaccaattatgagggg 3482818  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University