View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15758_low_27 (Length: 219)

Name: NF15758_low_27
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15758_low_27
NF15758_low_27
[»] chr7 (3 HSPs)
chr7 (18-207)||(40345753-40345942)
chr7 (83-171)||(40347745-40347832)
chr7 (18-47)||(40347638-40347667)


Alignment Details
Target: chr7 (Bit Score: 182; Significance: 1e-98; HSPs: 3)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 182; E-Value: 1e-98
Query Start/End: Original strand, 18 - 207
Target Start/End: Original strand, 40345753 - 40345942
Alignment:
Q  18 aattgatagatttgaaaatgatcagctgaatgagcaattaggaaatttgtggttttgtagatagggacgatttgttccctaggaaaatttgttgctatat 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  40345753 aattgatagatttgaaaatgatcagctgaatgagcaattaggaaatttgtggttttgtagatagggacgatttgttccctaggaaaatttgttgctatat 40345852  T
Q  118 gattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaatatttgatatggtgatcttctattctgagtataatct 207  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||| |||||    
T  40345853 gattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaatatttgatatggtgatcatctattctgagtagaatct 40345942  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #2
Raw Score: 55; E-Value: 9e-23
Query Start/End: Original strand, 83 - 171
Target Start/End: Original strand, 40347745 - 40347832
Alignment:
Q  83 gacgatttgttccctaggaaaatttgttgctata-tgattgatattatgttgtaaccggggaattaaattggtataatgacatcaacaat 171  Q
    |||||||| |||||||||||||||||||| |||| ||||||||||||||||  |||||||||||||| ||||||||||| ||||||||||    
T  40347745 gacgatttcttccctaggaaaatttgttgatatagtgattgatattatgtt--aaccggggaattaatttggtataatggcatcaacaat 40347832  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr7; HSP #3
Raw Score: 30; E-Value: 0.00000007
Query Start/End: Original strand, 18 - 47
Target Start/End: Original strand, 40347638 - 40347667
Alignment:
Q  18 aattgatagatttgaaaatgatcagctgaa 47  Q
    ||||||||||||||||||||||||||||||    
T  40347638 aattgatagatttgaaaatgatcagctgaa 40347667  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University