View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15758_high_17 (Length: 286)

Name: NF15758_high_17
Description: NF15758
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15758_high_17
NF15758_high_17
[»] chr3 (4 HSPs)
chr3 (31-268)||(991732-991962)
chr3 (108-226)||(1012143-1012257)
chr3 (155-226)||(1029454-1029525)
chr3 (170-220)||(1029404-1029454)


Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 4)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 31 - 268
Target Start/End: Complemental strand, 991962 - 991732
Alignment:
Q  31 tttgtcggtgtcttaccatagcgcttgtgaccagcgtgcgattagtctcaatagaaaaatcattagggtgttaaattaataaaggtctgctacggcgatt 130  Q
    ||||||||||||||||||||||||||||||||| |||||||||||||||||||||| ||||||||||||||||||| ||    |||||||||||||||||    
T  991962 tttgtcggtgtcttaccatagcgcttgtgaccatcgtgcgattagtctcaatagaacaatcattagggtgttaaatcaa----ggtctgctacggcgatt 991867  T
Q  131 ttagtcataacatggcggtttttgttgttgtcgaaaccacaatgcaactggaattgagactacatggcaaccgacaattatgcacaaacagaactcga-t 229  Q
    | |||||||||||| |||||||||||||   |||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||| |    
T  991866 t-agtcataacatgacggtttttgttgt---cgaaaccacaatgcaactggaattgagactacatggcaaccgacaactatgcacaaacagaactcgatt 991771  T
Q  230 catatatgacaattaattctctccatcaatgccattaat 268  Q
    |||||||||||||||||||||||||||||||||||||||    
T  991770 catatatgacaattaattctctccatcaatgccattaat 991732  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #2
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 108 - 226
Target Start/End: Complemental strand, 1012257 - 1012143
Alignment:
Q  108 aataaaggtctgctacggcgattttagtcataacatggcggtttttgttgttgtcgaaaccacaatgcaactggaattgagactacatggcaaccgacaa 207  Q
    ||||||||||||||||||| |||| |||||||| |||  ||||||    |||| ||||||||||||||||||| ||||||| ||||||   |||||||||    
T  1012257 aataaaggtctgctacggctatttgagtcataaaatgatggtttt----gttgacgaaaccacaatgcaactgcaattgaggctacatcataaccgacaa 1012162  T
Q  208 ttatgcacaaacagaactc 226  Q
    ||||||||||||| |||||    
T  1012161 ttatgcacaaacataactc 1012143  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #3
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 155 - 226
Target Start/End: Complemental strand, 1029525 - 1029454
Alignment:
Q  155 ttgttgtcgaaaccacaatgcaactggaattgagactacatggcaaccgacaattatgcacaaacagaactc 226  Q
    |||||| ||||||||||||||||||||||||||| |||||| ||||||||||||||  |||||||| |||||    
T  1029525 ttgttgacgaaaccacaatgcaactggaattgaggctacatcgcaaccgacaattacacacaaacataactc 1029454  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3; HSP #4
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 170 - 220
Target Start/End: Complemental strand, 1029454 - 1029404
Alignment:
Q  170 caatgcaactggaattgagactacatggcaaccgacaattatgcacaaaca 220  Q
    |||||||||||||||||||||||||| |||||||| ||||| |||||||||    
T  1029454 caatgcaactggaattgagactacatcgcaaccgataattacgcacaaaca 1029404  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University