View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15756_low_24 (Length: 233)

Name: NF15756_low_24
Description: NF15756
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15756_low_24
NF15756_low_24
[»] chr3 (1 HSPs)
chr3 (19-219)||(22944170-22944370)


Alignment Details
Target: chr3 (Bit Score: 193; Significance: 1e-105; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 193; E-Value: 1e-105
Query Start/End: Original strand, 19 - 219
Target Start/End: Complemental strand, 22944370 - 22944170
Alignment:
Q  19 atttatatggttttctagtgaaggaattatcagtgtttttgtttcattattgatttggagagttaggagctcttgccttatgtttagtatcattgattgt 118  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  22944370 atttatatggttttctagtgaaggaattatcagtgtttttgtttcattattgatttggagagttaggagctcttgccttatgtttagtatcattgattgt 22944271  T
Q  119 tgtggtgatctagttattggttttaggagtgtttttagactattctaattgttctttgtgatcttctgtttgcacatcttgttatatgttattagtatta 218  Q
    |||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||    
T  22944270 tgtggtgatctagttattggctttaggagtgtttttagactattctaattgttctttgtgatcttctgtttgcacatcttgttataggttattagtatta 22944171  T
Q  219 t 219  Q
    |    
T  22944170 t 22944170  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University