View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15753_low_19 (Length: 223)

Name: NF15753_low_19
Description: NF15753
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15753_low_19
NF15753_low_19
[»] chr1 (1 HSPs)
chr1 (12-206)||(46537456-46537650)


Alignment Details
Target: chr1 (Bit Score: 195; Significance: 1e-106; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 195; E-Value: 1e-106
Query Start/End: Original strand, 12 - 206
Target Start/End: Complemental strand, 46537650 - 46537456
Alignment:
Q  12 gataatactcaaggcgtatgattaaaccggggtgaaccggcatgcgaaccggttgacacgggttacacgaactacacttggatctacacgacggaggtgt 111  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46537650 gataatactcaaggcgtatgattaaaccggggtgaaccggcatgcgaaccggttgacacgggttacacgaactacacttggatctacacgacggaggtgt 46537551  T
Q  112 tgaccctggcccagcaagcttcttctgctccaccacctctctcttcttccacggtgatgtcggagacccgttttccattttttgatgcttcagta 206  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
T  46537550 tgaccctggcccagcaagcttcttctgctccaccacctctctcttcttccacggtgatgtcggagacccgttttccattttttgatgcttcagta 46537456  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University