View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF15747_low_9 (Length: 211)

Name: NF15747_low_9
Description: NF15747
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF15747_low_9
NF15747_low_9
[»] chr4 (1 HSPs)
chr4 (81-170)||(872294-872382)


Alignment Details
Target: chr4 (Bit Score: 45; Significance: 8e-17; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 45; E-Value: 8e-17
Query Start/End: Original strand, 81 - 170
Target Start/End: Complemental strand, 872382 - 872294
Alignment:
Q  81 acctctagcctcaatgttagataaaatgctaaataannnnnnngtcaatttaaatttttacccaacactttttcctatcccccataaatc 170  Q
    ||||||||||||||||||||||||||||||||||||        | |||||||||||||| |||||||||||||||| || |||||||||    
T  872382 acctctagcctcaatgttagataaaatgctaaataattttttttttaatttaaattttta-ccaacactttttcctaccctccataaatc 872294  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University